Genetic Polymorphism of ASB15 gene and Its Relationship with Productive Performance, Growth Traits, and Skeletal Muscles in Rose 308 broiler chicken Chickens

Abstract

The present study aimed to analyze the Polymorphisms of the ASB15 gene in broiler chickens and to determine the effects of single nucleotide polymorphisms (SNPs) within the gene sequence, as well as their impact on the peptide chain of the ASB15 protein . This gene was selected due to its important role in regulating skeletal muscle growth and improving production traits for chickens. The study included 50 broiler chickens. Genomic DNA was extracted from blood samples collected from the wing vein, and a specific fragment of the gene (exon 7, 740 bp) was amplified using Polymerase Chain Reaction (PCR) with the following primers: forward (GGTGCTTCTGTGTTAGGATTTT) and reverse (GGCTAACGGAAAGAAG-AAAGTG) annealing temperature was 56 C, Sequencing analysis was performed by Macrogen Company (Korea) to detect genetic variations.

The results revealed the presence of two point mutations, 287 A>G and 374 T>C, resulting in three genotypes at each locus. Allele frequency analysis indicated that alleles A and T were more frequent compared to the alternative alleles, suggesting their predominance in the studied population. The Chi-square test showed a deviation from Hardy–Weinberg equilibrium, which may be attributed to artificial selection, environmental factors, or less sample size. Furthermore, amino acid sequence analysis demonstrated that both detected mutations were silent mutations, as they did not lead to any change in the amino acid sequence (proline and asparagine remained unchanged), indicating no direct effect on protein structure. However, this polymorphisms may influence gene expression levels, which could be reflected in growth and production traits. The study concludes that the ASB15 gene has significant potential as a molecular marker that can be utilized in genetic selection programs to improve growth traits and increase meat production in broiler chickens. It is recommended that further studies be conducted to better understand the functional effects of these mutations and their impact on gene expression.

These findings also highlight the importance of integrating molecular analyses with production data in modern breeding programs. The use of molecular markers associated with growth-related genes, such as ASB15, may accelerate genetic improvement processes and enhance selection accuracy, thereby supporting sustainable and efficient poultry production.